                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G=-29.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCAGCCCGACGCCACGGTGGCGGCGCTGACCGAGCTGACCAAGCTGTCGGCGGCCG
ATCAGCTGGAGATGGTCAAGGGCGCCGACTGGTACACGGCCGCCGAGCAGGGCGCGCT
GCTGGCGCCGGGCAGCAAGTACATCGACGGCCTGCAGAAGCTGGCCGAAATGATGGTG
CGCTACGACCAGATCGACAAGGCGCCGCCGGTGCGCGAGTGGGTCGACGCGGCGTACC
TGTAAgccgacacgattgtcctgccggcgggcgaggctgcccgccggttctttgcctggatttgaacgATG

    BPP0091 --- BPP0092 --- BPP0093 Gene: BPP0091     GI: 33594811     BI number: BPP0091     GOG: COG0600     Description: ABC transport system permease protein Gene: BPP0092     GI: 33594812     BI number: BPP0092     GOG: COG1116     Description: ABC transporter ATP-binding protein Gene: BPP0093     GI: 33594813     BI number: BPP0093     GOG: COG0665     Description: conserved hypothetical protei   C G  C CG CG GT CG GC G  G A  | A  | C  |       ga A  |      c  t GC        at CG        cg TA        at A  G       gc G  T      |  c A  G      c  t CG        cg CG        gc AT       A  c GC       A  g CG        Tg |  A       Gc        gg |  C       Tg       a  c |  G       Cg        gt A  C       Cg        cg TG       A  |       gc CG       T  |       gc GC        Gc        gc CG        Cg        cg GT       G  a       gc TA       G  g       gc GC        Cg        cg GC        Gc        cg                         ttctttgcctggatttgaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here     ..................................................................................................................