                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-27.50 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-22.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGACCTGGCCCAGGCCAAGAACGATGGCGTGGTGACCTTCGGCAACCTGGACTACC
CGCCGCAACACGGCTGAtccccccggcgccccccctcgccgcagccgtaagtgccggcgcccgccctgtacagagggacgggcgccgt
tttttttgcctctgccatgcaggcgtcggaacggtggaaaatttcgacgatttgattgattatttccatcaaaacgacgttttcaccgctacatatcgac
agcagcgctcgttagcatggttgcatgcccgcaaccctcgcccgggagcccgccATG

    BPP0098 Gene: BPP0098     GI: 33594818     BI number: BPP0098     GOG: COG1748     Description: putative dehydrogenas cc c  c c  c c  t gc cg gc gc cg c  | c  | c  | c  | c  | t  | A  |                 ac Gc                 t  a Ta                 g  g Cg                  ta Gc                  cg Gc                  cg Cg        cc        cg At       g  c      |  a |  a       cg        gc C  a       gc        cg A  g       gc        cg At       |  c       cg Cg       c  t       gc |  c       cg        cg Gc        gt        gc Cg        ta        gc Cg        gc        cg                         ttttttttgcctctgccatgcaggcgtcggaacggtggaaaatttcgacgatttgattgattatttccatcaaaacgacgttttcaccgctacatatcgacagcagcgctcgttagcatggttgcatgcccgcaaccctcgcccgggagcccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1748 Saccharopine dehydrogenase and related proteins ... can be seen here     ..................................................................................................................