                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=28 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-35.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCAAGGCCAAGCTGCGTAAGGAACTTACCGAAGTAGAGCGTTCGAACGACTACAA
GTTCTGGATCGAATTCACGGATACGCGGTTTGGCGGCGTGGCGCGTCTTTACATCAAG
GTGATCTCCACCTTGTGAcggcgcgcctctggatgacgcaggcccgggccgatgcaccggcccgggcctgcctgtccgcgcaggaat
agattcagaatgctttgaatcgttttgcaatattttttccgctgccccgcccggcaattgcttatgatccggcattcccacaataacaagcatcgccAT
G

    BPP0105 --- BPP0106 --- BPP0107 --- BPP0108 Gene: BPP0105     GI: 33594825     BI number: BPP0105     GOG: COG3000     Description: putative desaturase Gene: BPP0106     GI: 33594826     BI number: BPP0106     GOG: NOG41072     Description: putative fatty acid desaturase Gene: BPP0107     GI: 33594827     BI number: BPP0107     GOG: COG0332     Description: conserved hypothetical protein Gene: BPP0108     GI: 33594828     BI number: BPP0108     GOG: NOG39228     Description: conserved hypothetical protei                      tg gc                 a  c t  a                 at a  c                 gt gc        gc        at cg       t  c       cg cg       c  t       ta gc        cg        ta gc        gt        at gc        gc        gc cg        gc       a  g cg        cg       t  | cg       c  c      a  | gc        cg        at gc        gc        gt at       g  a       gt cg        cg        at gc        cg        cg                         caatattttttccgctgccccgcccggcaattgcttatgatccggcattcccacaataacaagcatcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG3000 Sterol desaturase ... can be seen here [I] COG0332 3-oxoacyl-[acyl-carrier-protein] synthase III ... can be seen here     ..................................................................................................................