Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=25 nt.     Delta G=-10.80 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-18.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCAGCGGGCCATCGAACTGTTCCAGCCCGACGCCCTGGTGCTGTCGCTGGGCTTCG
ATATGTTCGAGAAAGACCCGCAAGCCATGGTGGCGGTCAGCGCCAATGGCTTCGAGCG
CCTGGGCCAGGCGATCGGCGCCTTCAAGCTGCCGACGCTGATCGTGCAGGAAGGCGGC
TACTATATCGAGGGCCTGGAGGACAACGCCGAGCGCTTCTTCGCGGGCCTGGCCAAGG
CCTGAggtcccgcctgtcgatccggaaaaggcggccgcggccgccttttttcatgcctgccccaaaccATG

    BPP0198


Gene: BPP0198     GI: 33594916     BI number: BPP0198     GOG: COG0583     Description: putative transcriptional regulato


  C
G  C
G  A
 TA
 CG
 CG
 GC
 GC
 GT
C  |
G  |
 CG
 TA
 Tg         t
 Cg       a  c
T  t       gc
T  c       cg
C  c       tg
 Gc       |  a       gc
 Cg       |  a      c  g
 Gc       g  a       cg
A  c       ta        gc
 Gt        cg        gc
 Cg        cg        cg
C  t       gc        gc
 Gc        cg        gc
 Cg        cg        at
                        tttttcatgcctgccccaaaccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0583 Transcriptional regulator ... can be seen here

    ..................................................................................................................