                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-12.21 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGCGTAGCCCTCGCGCTTGAGCAATTCGCCCGCCTTGCGGGCCTGCTCGCGGCCGGT
TTCGGTCAGGTCCACATCGGTCCAGCCCGTGAAACGGTTTTCCAGGTTCCACTGGCTT
TCGCCGTGGCGTATCAGAACAAGTTTGTACATggtgtaggccgcaacctgagcgggttaaagttgaacaatgcggt
cattttataattgactggtttttctctgcttttccccctggcccgccctgtttcgcggcgcggccgggccgttgtttccaggctcgcgccgcccccctag
gatgccctGTG

    BPP0294 --- grxC --- secB --- gpsA --- BPP0290 Gene: BPP0294     GI: 33595008     BI number: BPP0294     GOG: COG0607     Description: conserved hypothetical protein Gene: grxC     GI: 33595007     BI number: BPP0293     GOG: COG0695     Description: glutaredoxin 3 Gene: secB     GI: 33595006     BI number: BPP0292     GOG: COG1952     Description: protein-export protein Gene: gpsA     GI: 33595005     BI number: BPP0291     GOG: COG0240     Description: glycerol-3-phosphate dehydrogenase [NAD(P)+] Gene: BPP0290     GI: 33595004     BI number: BPP0290     GOG: COG3181     Description: putative exported protei                      ag                     g  c                      tg TC                  cg T  C                 cg G  A       GT        at GC       A  T      |  t AT        AT       |  a CG        CG       |  a CG        AT       |  a |  C      |  A      |  g |  T      A  C      |  t T  T      G  A      |  t T  T       AT       |  g T  C       Cg       |  a TG        Tg       |  a GC        At       |  c GC        Tg       |  a CG       |  t      |  a AT       |  a       at A  G      G  g       cg A  |       Cg        gc G  |       Gc        cg TG        Gc        cg GC        Tg        gt CG        Gc        gc                         attttataattgactggtttttctctgcttttccccctggcccgccctgtttcgcggcgcggccgggccgttgtttccaggctcgcgccgcccccctaggatgccctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0607 Rhodanese-related sulfurtransferase ... can be seen here [O] COG0695 Glutaredoxin and related proteins ... can be seen here [U] COG1952 Preprotein translocase subunit SecB ... can be seen here [C] COG0240 Glycerol-3-phosphate dehydrogenase ... can be seen here [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................