Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-23.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCGGGCGAAGCGCTGTAGTCGGCCAGGCTTTCCATCGAGCCCTTGCCGGTCTCCAG
CCAGTCCAGGTTCACCTGCAGGGCGGCCGCCAGCTTGCGAACCGAACGGCTGGATTGC
CGTTGGCCGTTCTCGTAGCTGGCTACCGCGCTTTGCGACAGGCCGCTGGCGCGCGCCA
GATCCTGTTGCGTTAGCGAACGCAGTGCCCGCGCATGTTTCAATCGGTCTGAGAATGT
CTTCACggcctgattgaatcgtgcgaatcaagcactatggtggttgaatttattatgttggtgttgaaATG

    BPP0307


Gene: BPP0307     GI: 33595021     BI number: BPP0307     GOG: -------     Description: putative transcriptional regulato


 TG
A  T
A  C
 GT
 AT
 GC
 TA
|  C
 Cg
 Tg
 Gc
 Gc
|  t
 Cg
 Ta
 At
 At
 Cg                  at
 Ta                 t  g
 Ta         t        cg
T  t      a  c       at
 Gc       a  a       cg
 Tg       g  a      g  g
 At        cg        at
 Cg        gc        at
 Gc        ta        cg
 Cg        gc        ta
                        atttattatgttggtgttgaaATG


    ..................................................................................................................