                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.94 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cccgcgccgatgcgggcggaacacgtgcgccgcgttcgatcacggcttgccaaatcgtaaagctgcgggactgttgttccgtgaacgcaggtcgtccatc
cagaaaggccgccgtcatgcgcatgatggctcgggcgaggaacccatgctgtgctggatcggcaaggcctaagcccctggcgccccccctgtgcaaagct
gagggtcaggtgtgaagaccgagtgggcagcgtttgcgagggccttttttatgtactccattcggaagtacaatgattcctcattcccgagggcttccct
ATG

    BPP0379 --- BPP0380 Gene: BPP0379     GI: 33595090     BI number: BPP0379     GOG: COG4453     Description: conserved hypothetical protein Gene: BPP0380     GI: 33595091     BI number: BPP0380     GOG: COG0454     Description: acetyltransferase (GNAT) family protei            ga           t  a           g  g            ta   a        gc a  a       gc cg       a  g gc       c  a t  t      t  g g  g      g  t ta       g  g cg       g  g       tt cg       a  g      t  g cg        gc        gc |  t       ta        cg c  c       cg       |  a c  a       gc       g  g cg       |  g      a  g cg        at        cg gt        at        gc cg        at        gc gt        cg        gt                         tttttatgtactccattcggaagtacaatgattcctcattcccgagggcttccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4453 Uncharacterized protein conserved in bacteria ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................