Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions

CGCGCGTGCTCGAACTGTTCGACATCGAAGTGCCGGGCCCGCACTGGGCCGGCATGTA
Gcgcgccccgtatccgcccgcgcccgtaccgaagcctgtccccgtggggcaggcttgtttgcgtctgagcgcgagaagccgcggcagggaatcccccgat
attgacaccggacaattattcagtactatgcgcaattaattcagtgtactgagtagaagcatagaagcacctggctgtttgttgttccgatcaagatcca
gccgcccgcattctgcgggcggcggccacaaggggaatacagATG

    BPP0386 --- BPP0387 --- BPP0388 --- BPP0389


Gene: BPP0386     GI: 33595097     BI number: BPP0386     GOG: COG3181     Description: putative exported protein
Gene: BPP0387     GI: 33595098     BI number: BPP0387     GOG: NOG43948     Description: 4,5-dihydroxyphthalate decarboxylase
Gene: BPP0388     GI: 33595099     BI number: BPP0388     GOG: COG1319     Description: molybdopterin dehydrogenase
Gene: BPP0389     GI: 33595100     BI number: BPP0389     GOG: COG2080     Description: probable 2Fe-2S ferredoxi


           g
         c  t
          cg
          cg
          cg
          tg
          gc
          ta
          cg
          cg
          gc
            ttgtttgcgtctgagcgcgagaagccgcggcagggaatcccccgatattgacaccggacaattattcagtactatgcgcaattaattcagtgtactgagtagaagcatagaagcacctggctgtttgttgttccgatcaagatccagccgcccgcattctgcgggcggcggccacaaggggaatacagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here
[C] COG1319 Aerobic-type carbon monoxide dehydrogenase, middle subunit CoxM/CutM homologs ... can be seen here
[C] COG2080 Aerobic-type carbon monoxide dehydrogenase, small subunit CoxS/CutS homologs ... can be seen here

    ..................................................................................................................