                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGCTGTTGGCTTCGACCACGCGCACGAAGACCTGCATGGCTTGGAAACGGTCCATg
gcggcgtcctgaataagtgtgtgcgcaaagcataacgctgttttggcctggattgttcgtccggaacaaacagtgttgacggccagccattgtttatccg
gaccgacaaaacactcagaatttgtccatccgaatcgcccgccggctctccagccgtccgtcgcacccccggggcgctgcgctcgcagccccggccggcg
gggcccgtttctcccctatcagcccagtttcaaggaaacaccATG

    BPP0435 --- BPP0434 --- BPP0433 Gene: BPP0435     GI: 33595144     BI number: BPP0435     GOG: COG0845     Description: HlyD family secretion protein Gene: BPP0434     GI: 33595143     BI number: BPP0434     GOG: COG0841     Description: putative multidrug-efflux system protein Gene: BPP0433     GI: 33595142     BI number: BPP0433     GOG: COG1538     Description: putative exported protei AA G  A GC TG TG C  T        a GC       a  t GC       g  a        a TA        ta       c  a AT        cg       g  a |  g      c  t       cg Cg       t  g       gc Gc        gt        ta Tg        cg        gt Cg        gt       |  a |  c      |  g       ta Cg        gc        gc At        cg        tg Gc        gc        gc                         tgttttggcctggattgttcgtccggaacaaacagtgttgacggccagccattgtttatccggaccgacaaaacactcagaatttgtccatccgaatcgcccgccggctctccagccgtccgtcgcacccccggggcgctgcgctcgcagccccggccggcggggcccgtttctcccctatcagcccagtttcaaggaaacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG0841 Cation/multidrug efflux pump ... can be seen here [MU] COG1538 Outer membrane protein ... can be seen here     ..................................................................................................................