                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agacgtgcctgtccccgccgggggagcgacacctgcggccagggtgcctgtccccgcggggacaggcacccgtcaagcgacggtatctgttctttcccgc
ctgcagcccacgttttgagacggcccttacgggccgtttttcttgcgtgcgtcacgccgattccgcttgcgcgggaaatatttgtcccgtattatgggat
caaatctcaatttgcgggattaataaaaagccgcgccagcggctgccatcacccactgcgcgactgggctgccttcagtctgcgcatcaggagacaaacg
ATG

    BPP0454 --- BPP0455 --- BPP0456 --- BPP0457 --- BPP0458 --- BPP0459 Gene: BPP0454     GI: 33595162     BI number: BPP0454     GOG: COG3181     Description: putative exported protein Gene: BPP0455     GI: 33595163     BI number: BPP0455     GOG: COG0318     Description: putative substrate-CoA ligase Gene: BPP0456     GI: 33595164     BI number: BPP0456     GOG: COG1414     Description: probable transcriptional regulator Gene: BPP0457     GI: 33595165     BI number: BPP0457     GOG: COG1024     Description: probable enoyl-CoA hydratase/isomerase Gene: BPP0458     GI: 33595166     BI number: BPP0458     GOG: COG0599     Description: probable carboxymuconolactone decarboxylase Gene: BPP0459     GI: 33595167     BI number: BPP0459     GOG: COG3181     Description: putative exported protei ag a  c cg ta gc c  | cg cg at         g c  a      a  c g  t      c  c gc        gc at        ta cg       c  c at        cg gt        gt |  c      c  t |  t      c  t |  t      c  t |  t      t  | gc        tg gc        ta gc        cg cg       t  |       ta gc        ta       t  c c  c       gc        cg c  t       tg        cg c  |       cg        cg c  |      t  c       gc tg       a  |       gc gc       t  |       cg ta        gc        at cg        gc        gt                         tttcttgcgtgcgtcacgccgattccgcttgcgcgggaaatatttgtcccgtattatgggatcaaatctcaatttgcgggattaataaaaagccgcgccagcggctgccatcacccactgcgcgactgggctgccttcagtctgcgcatcaggagacaaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here [K] COG1414 Transcriptional regulator ... can be seen here [I] COG1024 Enoyl-CoA hydratase/carnithine racemase ... can be seen here [S] COG0599 Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit ... can be seen here [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................