                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-22.10 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-15.80 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGCCGGCTATGCGGCCAACGACCTGCAGGTCGGCCAGACCGGCAAGATCGTGGCGC
CGCAGCTGTATATCGCGGTGGGCATTTCCGGGGCCATCCAGCACCTGGCGGGCATGAA
GGACTCCAAGGTCATCGTGGCGATCAACAAGGATGCCGAGGCCCCCATCTTCGCGGTG
GCGGACTACGGCCTGGAGGCGGACCTGTTCCAGGCGGTTCCGGAGCTGATCGGCGCCC
TCTGAggcgcgacggtcgcaatcgccggtcgcgcgcatgcgcggccggttttttttgagcgagttggcATG

    BPP0616 Gene: BPP0616     GI: 33595317     BI number: BPP0616     GOG: COG3777     Description: conserved hypothetical protei            aa CT       c  t T  G       gc C  A       cg Cg       t  | Cg        gc Gc        gc        ca Cg       |  g      g  t Gc        cg        cg |  g       at        gc |  a       gc        cg Gc        cg        gc Cg        gc        cg Tg        cg        tg At        gc        gc Gc       g  g       gc T  |      A  |       cg Cg        Gc        cg Gc        Ta        gt                         tttttttgagcgagttggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3777 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................