                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGGCCGCATCGCGGCGGGCTCGGAGCAGACCCGCGCGTTGCGCCTGACGCACGAGC
AGCTGGCCCGCATGACCGGCCTGAGCCGGGTGACGGTGACCCGCGCGCTGAAAGCCAT
GGCCGAGGAGGGACTGGTCGACACGCGCGGCAAGGGCGTGGAGATCCGCGACGCCGAG
CGCCTGCGCGCGCGGCTGGGGCCGTTCTGAggccggcgtgagaatccccgcggttttgtagcgcgcgatacaacccgc
tgcctgctttgtttctacagtgatggttttcacggggaagcgggcggcATG

    BPP0643 Gene: BPP0643     GI: 33595344     BI number: BPP0643     GOG: COG1028     Description: probable short chain dehydrogenas GG T  G CG GC GC CG        aa GT       g  t C  T      a  c G  C      g  c C  |      t  c GT        gc CG        cg        ca G  |      g  |      a  a TA        gc       t  c Cg        cg       a  c Cg        cg        gc Gc        gt        cg C  |       gt        gc G  |       At       |  t A  |       Gt        cg Gc       T  g       gc Cg       C  t      c  | Cg        Ta        gc Gc        Tg        at Cg        Gc        tg At        Cg        gc                         tttgtttctacagtgatggttttcacggggaagcgggcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:67 nt.     Distance to run of Ts=2 nt.   Size=37 nt.     Delta G= -9.40 kcal/mol Antiterminator: Size=45 nt.     Delta G=-17.90 kcal/mol Anti-antiterminator:   Size=37 nt.     Delta G=-18.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTGGGCCGCATCGCGGCGGGCTCGGAGCAGACCCGCGCGTTGCGCCTGACGCACGAGC AGCTGGCCCGCATGACCGGCCTGAGCCGGGTGACGGTGACCCGCGCGCTGAAAGCCAT GGCCGAGGAGGGACTGGTCGACACGCGCGGCAAGGGCGTGGAGATCCGCGACGCCGAG CGCCTGCGCGCGCGGCTGGGGCCGTTCTGAggccggcgtgagaatccccgcggttttgtagcgcgcgatacaacccgc tgcctgctttgtttctacagtgatggttttcacggggaagcgggcggcATG     BPP0643 Gene: BPP0643     GI: 33595344     BI number: BPP0643     GOG: COG1028     Description: probable short chain dehydrogenas            TG           C  C            CG            GC GA        CG        cg A  T       GC       c  g GC       A  G      g  c GC        GC       g  g TG        CG       A  t GC        CG       G  g CG        GC        Ta G  A      C  |       Cg G  C      A  |       Ta G  |       GT        Ta A  |       CG        Gt A  |      G  G      C  | CG        CG       C  | GC        CG        Gc GC       |  C       Gc CG       T  C       Gc G  A      A  G       Gc CG        GT       T  | GC        AT        Cg CG        GC        Gc                         ggttttgtagcgcgcgatacaacccgctgcctgctttgtttctacagtgatggttttcacggggaagcgggcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................