                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -7.67 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTGCTCAAGGGCATGTACGGCATCGGCGTGGCGATCTACCTGGCCCGCCAGCCCGTC
GCCGCGCTCAGCATCGCCGCCCACTACGGCCGCATGGGCCCGGACCGCCGCAAGACCA
TCGCCGCCGCGCTCAAGCGCGAGGCCGACCGGGTGACCGAGGAACTGGGGTAGgcggcgcg
gccgcaaaaaaatggaaaatgaccacaatatcagtccttagttgaattaaggactggaattgcggtcttttcatggattcaataaaatgacgccaatctc
agtcattacgatgttttaagactATG

    BPP0646 --- BPP0645 Gene: BPP0646     GI: 33595347     BI number: BPP0646     GOG: -------     Description: conserved hypothetical protein Gene: BPP0645     GI: 33595346     BI number: BPP0645     GOG: COG3550     Description: conserved hypothetical protei   c g  g cg gc gc        ca cg       a  a gc       c  t |  a      c  a        g |  a       at       t  a |  a       gc        ta |  a       ta        gt |  a      a  g       at |  a      a  |       ta |  a      a  |       ta |  t       at        cg |  g       gc        cg |  g       gc        ta |  a      t  t       gc |  a      a  t       at |  a      a  a       cg |  a      a  g       tg G  t      a  |      a  a A  g      a  |       ta Ta        at        at Gc        at        at Gc        cg        cg                         cggtcttttcatggattcaataaaatgacgccaatctcagtcattacgatgttttaagactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3550 Uncharacterized protein related to capsule biosynthesis enzymes ... can be seen here     ..................................................................................................................