                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGGGCGGTTGAAACGATTACGGCTTCTCTCATcgctgtctccttgttgtgcctgggatgtgaggatggagacg
actatatcgacggccgaaatcgggcggcaaccgactatttcgcagcggtggctcagtttttctcagccaggtttcttctggttgagtttttgtaggccag
cgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatc
cataaaacagtgacaggagacaaccATG

    BPP0659 --- BPP0660 --- BPP0661 Gene: BPP0659     GI: 33595357     BI number: BPP0659     GOG: COG3181     Description: putative exported protein Gene: BPP0660     GI: 33595358     BI number: BPP0660     GOG: COG1042     Description: putative acetyl-CoA synthetase Gene: BPP0661     GI: 33595359     BI number: BPP0661     GOG: COG1042     Description: conserved hypothetical protei   t t  c                  t t  g                t  c a  c                t  t ta         t        gt cg       t  t       gc a  |      t  t       at gc        gc        cg cg        at        cg cg       c  c       gt at        ta        at a  g       cg        cg cg        gc        ta gc        gc        cg                         tttttgtaggccagcgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatccataaaacagtgacaggagacaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here [C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here [C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:148 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -6.70 kcal/mol Antiterminator: Size=26 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGCGGGCGGTTGAAACGATTACGGCTTCTCTCATcgctgtctccttgttgtgcctgggatgtgaggatggagacg actatatcgacggccgaaatcgggcggcaaccgactatttcgcagcggtggctcagtttttctcagccaggtttcttctggttgagtttttgtaggccag cgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatc cataaaacagtgacaggagacaaccATG     BPP0659 --- BPP0660 --- BPP0661 Gene: BPP0659     GI: 33595357     BI number: BPP0659     GOG: COG3181     Description: putative exported protein Gene: BPP0660     GI: 33595358     BI number: BPP0660     GOG: COG1042     Description: putative acetyl-CoA synthetase Gene: BPP0661     GI: 33595359     BI number: BPP0661     GOG: COG1042     Description: conserved hypothetical protei   t t  c t  g a  c        t ta       t  t cg       t  t a  |       gc gc        at cg       c  c cg        ta at        cg a  g       gc cg        gc gc        ta             ggtttcttctggttgagtttttgtaggccagcgggaaaaaaagtcgtttgccggccgggatggcgctcgccgaacatgtgtgcgccggccaagctgccaccgcgagaccttccgacgggaagcccgcaatccataaaacagtgacaggagacaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here [C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here [C] COG1042 Acyl-CoA synthetase (NDP forming) ... can be seen here     ..................................................................................................................