                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-19.10 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-20.11 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGCCGTCGTACCGCGCCGGGTCTACGCCCAGCTGCTGCAACAGGCGCCTGGTTTCC
TCGGGAGTCGCGCTATGCACTGTCGTCATgatctggatcctttcaggtgatggtcgcaagcggcgggcggcgcgggccg
cgcctccggcagatggctgccggaccgccagttttctattttatggaaatcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggc
gcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG

    BPP0669 Gene: BPP0669     GI: 33595367     BI number: BPP0669     GOG: COG1802     Description: putative GntR-family transcriptional regulato cc t  t at gt gc ta cg tg at        cg g  g      g  g Ta        cg At        gc Cg        gc |  g       cg |  t       gc |  c      |  g |  g       gc        tg |  c       gc       a  g |  a      c  t       gc |  a       gc        at Tg        gc        cg Gc        cg        gc Cg       g  |       gc Tg       a  |       cg Gc       a  |       cg Tg        cg        ta Cg        gc       c  c A  |      |  a      c  | Cg        cg        gc Gc        ta        cg Tg        gt        gc                         cagttttctattttatggaaatcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggcgcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:125 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-18.60 kcal/mol Antiterminator: Size=41 nt.     Delta G=-19.10 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-19.21 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCCGCCGTCGTACCGCGCCGGGTCTACGCCCAGCTGCTGCAACAGGCGCCTGGTTTCC TCGGGAGTCGCGCTATGCACTGTCGTCATgatctggatcctttcaggtgatggtcgcaagcggcgggcggcgcgggccg cgcctccggcagatggctgccggaccgccagttttctattttatggaaatcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggc gcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG     BPP0669 Gene: BPP0669     GI: 33595367     BI number: BPP0669     GOG: COG1802     Description: putative GntR-family transcriptional regulato cc t  t at gt gc ta cg tg        gg at       g  c       tg g  g       cg       a  g Ta        gg        gc At        gc        at Cg        cg        cg |  g       gc        gc |  t      |  g       gc |  c       ag        cg |  g       ag        cg |  c      c  c       ta |  a       gc       c  | |  a       cg       c  | Tg        tc       g  | Gc       g  |      c  | Cg       g  |      g  | Tg       t  |      c  | Gc        ag       c  | Tg        gc       g  | Cg       |  c       gc A  |       tt        gc Cg        gc        cg Gc        gc        gc                         cagttttctattttatggaaatcaattccaaaaatatgataaatgaaaaatcggcttcggcacaacaccggcgcacgagacgggcgcggacccgttgcactactatctgccgggctgcccccttgatgcgagtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................