                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-30.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGTCCTCATTGCGCAGGCGCACCGTGTACCCGGCCACGATGCCGCTGCGCTCGAGC
CGCGCCATGCGGTTCTGCACCGTTCCGCGCGACACGTGCAGCTGGCGGGCCAGCGTGG
CGGTGGGCAGGCGGGCGTCCGCGCGCAGCAGCGCCAGCAGGCGGCGGTCCAGGGCGTC
GAGCGCATGATCCATGGCAGTCTCCAGGCCGTTTGGGCAGATCGCCAGCCGTAGCTGG
CGATCTGCTCCATATTGCCTCAGGATTGCCATttttctggcttttcgctagccgggcatttccctaagATG

    BPP0748 --- BPP0749 Gene: BPP0748     GI: 33595440     BI number: BPP0748     GOG: COG4992     Description: ornithine aminotransferase Gene: BPP0749     GI: 33595441     BI number: BPP0749     GOG: COG0010     Description: arginas GT        AT C  A      C  A CG       C  T GC       T  T AT        CG CG        GC CG       |  C GC       |  T CG       |  C TA       |  A AT        TG GC        CG AT        TA CG        AT GC        GT |  T       CG GC        GC GC        GC TA        TA             TttttctggcttttcgctagccgggcatttccctaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4992 Ornithine/acetylornithine aminotransferase ... can be seen here [E] COG0010 Arginase/agmatinase/formimionoglutamate hydrolase, arginase family ... can be seen here     ..................................................................................................................