                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-22.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCAGCGCCGGCGCGGGCCGGGCCCAGTGCTACCAGGTGCGCGACAGCGCCTCCCAGC
CCTGGCAGCTGTGGTACGGGGACATCACCGGTTTCGCCTTCCAGCCCGGCATCGAATA
CCGGCTGCGCGTGGTGGAAGTGCGCGACCCCAATCCGCCGGCCGACGCGTCGGGGGTG
CGCTGGGTGCTCGACCACGTGGTCGAGCAGCGCGTGGCGGCGCCGCGTCCAGCCCCCG
CGCCGTAGcgccttggcggggcggtttactattacgccctgtttttccttcgttcgtgcttttccgccATG

    BPP0754 Gene: BPP0754     GI: 33595446     BI number: BPP0754     GOG: COG1054     Description: conserved hypothetical protei            GT           C  A            CG            Gc            Cg CG        Gc G  T      C  c C  C      C  t C  C      C  t G  A       Cg CG        Cg         c GC        Gc       a  t GC       A  |      t  a C  |       Cg       t  t GC        Cg       t  t GC        Tg       g  a T  |      G  |       gc GC        Cg        cg CG        Gc        gc GC        Cg        gc CG        Cg        gc GC        Gt        gt                         gtttttccttcgttcgtgcttttccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1054 Predicted sulfurtransferase ... can be seen here     ..................................................................................................................