                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-12.39 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccggcgagcccgagttcgacgtctgcctgtgcgccatcgccaaggtcgagcgccgcatcgacgccggcccgcaggaagacctgcggccgtttttcggccg
ctacgagcaggccgtcgcggcgcgccggcccgacatcattcgctgacgccgcgcgccggcgggcgcacccgctttcaatccgtcctacaattccccgagg
tcggcccgctcgtcgggccggttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagcgcccgc
ATG

    BPP0765 --- BPP0766 --- sodA Gene: BPP0765     GI: 33595456     BI number: BPP0765     GOG: COG1982     Description: probable orn/arg/lys decarboxylase Gene: BPP0766     GI: 33595457     BI number: BPP0766     GOG: COG2081     Description: putative exported protein Gene: sodA     GI: 33595458     BI number: BPP0767     GOG: COG0605     Description: superoxide dismutase [Mn cc g  g cg gc cg g  | cg cg gc cg a  | gc ta |  c |  c |  c cg gc         t |  t      t  c |  t      a  c        c c  t      a  c      t  g t  c      c  c      c  t t  a      a  g       gc a  a       ta        cg c  t       cg        cg t  c       cg        cg a  c      t  t       gc cg        gc        gc at        cg        cg gc        cg        tg                         ttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagcgcccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1982 Arginine/lysine/ornithine decarboxylases ... can be seen here [R] COG2081 Predicted flavoproteins ... can be seen here [P] COG0605 Superoxide dismutase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:207 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.40 kcal/mol Antiterminator: Size=44 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:   Size=30 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ccggcgagcccgagttcgacgtctgcctgtgcgccatcgccaaggtcgagcgccgcatcgacgccggcccgcaggaagacctgcggccgtttttcggccg ctacgagcaggccgtcgcggcgcgccggcccgacatcattcgctgacgccgcgcgccggcgggcgcacccgctttcaatccgtcctacaattccccgagg tcggcccgctcgtcgggccggttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagcgcccgc ATG     BPP0765 --- BPP0766 --- sodA Gene: BPP0765     GI: 33595456     BI number: BPP0765     GOG: COG1982     Description: probable orn/arg/lys decarboxylase Gene: BPP0766     GI: 33595457     BI number: BPP0766     GOG: COG2081     Description: putative exported protein Gene: sodA     GI: 33595458     BI number: BPP0767     GOG: COG0605     Description: superoxide dismutase [Mn             a           c  t            gc            cg           c  a            gc            cg            gc           a  |            gc            cg            tg aa        gc c  g       gc cg       a  | gt       a  |       ag |  c      c  |      a  a cg       c  |       gc ta       g  |       gc |  g      c  |       at a  c      t  |       cg c  g      a  |       gc c  c      c  |      c  | gc       c  |       cg cg        gc        cg gc        cg        gc ta        gc        gc Gt        ta        cg                         tttttcggccgctacgagcaggccgtcgcggcgcgccggcccgacatcattcgctgacgccgcgcgccggcgggcgcacccgctttcaatccgtcctacaattccccgaggtcggcccgctcgtcgggccggttgcttttttgtcaccagcccgaccccgtctggcagtacactcgcgtccgttttgccttgcccgcccaggagcgcccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1982 Arginine/lysine/ornithine decarboxylases ... can be seen here [R] COG2081 Predicted flavoproteins ... can be seen here [P] COG0605 Superoxide dismutase ... can be seen here     ..................................................................................................................