                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-16.20 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-15.61 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGCTTTGCCGATATGGCCACCCATGTCATCGAATGCACCGGTGTGGGCGTGACCAC
TTCCGACTATGGCCAGGTCGAGTTCCGGCATGTGCGCCGGCCTGTCTATCCGCTCGAC
GCCATCTAGgcgcttggccgcgcttttgcggcctgtcccgctgtttttgaacattttgtcgtcttttgtaatatgtttcgcccgctccggccac
gccgctcgctatactcgccgccagccttcgggctacgcatataagcggcccgtgcgcgtggcatggccgcacttccataaggcatagaagATG

    BPP0777 Gene: BPP0777     GI: 33595467     BI number: BPP0777     GOG: COG5339     Description: conserved hypothetical protei GT T  G A  C CG GC GC         G CG       C  A CG       T  C T  |       CG T  |       GC G  |      |  C A  |      C  A G  |      C  T C  |      T  C       tt T  |       AT       c  t GC        TA        gt GC        CG        cg AT        Tg        gc CG        Gc        cg C  T       Tg        cg GC       |  c       gc GT       |  t       gc TA       |  t      |  t AT        Cg       |  g |  C       Cg       t  t |  C       Gc       t  c T  G       Gc       c  c C  C       Cg        gc AT       |  c       cg GC        Cg        gc CG        Gc        Gt                         gtttttgaacattttgtcgtcttttgtaatatgtttcgcccgctccggccacgccgctcgctatactcgccgccagccttcgggctacgcatataagcggcccgtgcgcgtggcatggccgcacttccataaggcatagaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5339 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................