                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -5.43 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-11.83 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctgaacgcctgcacgacctgctcgaccagcgaaggcgcctgcgcgcggccgcgcacgggttggaaatcgatcacggaaggtctgccaggtagatttctg
tacagttagccagaatccaactatacagttagcggtatttacgtcgattgtatattttcattccctggcaggcgggccagaatcgatctcgtcccctgcc
cggccaccgcacgcgcggtcggcgcacaccgcaggcgttacctctggagcgaccctcatagaatgcccccgccagcccgcccgacctgtcgcatctctgg
ATG

    BPP0784 --- mmsA Gene: BPP0784     GI: 33595474     BI number: BPP0784     GOG: COG0161     Description: omega-amino acid--pyruvate aminotransferase Gene: mmsA     GI: 33595473     BI number: BPP0783     GOG: COG1012     Description: putative methylmalonate-semialdehyde dehydrogenase [acylating   a c  g cg gt ta cg ta g  | gt         a at       c  a at       c  c gc       t  t gt       a  a cg       a  t        t at       g  a      a  t c  a      a  c      t  t t  c      c  a      g  a a  a       cg        gc g  g       gt        cg c  t       at        gt t  t       ta       a  c a  a       tg       t  g a  g       gc        ta a  |      a  g       gt gc        cg        at gc        at        cg ta        ta        at tg        gt        ta                         tattttcattccctggcaggcgggccagaatcgatctcgtcccctgcccggccaccgcacgcgcggtcggcgcacaccgcaggcgttacctctggagcgaccctcatagaatgcccccgccagcccgcccgacctgtcgcatctctggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0161 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase ... can be seen here [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................