                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.20 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-18.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATTCTCGGCGCGCGGGGCGGTGAAGGCCGTGCCGGACAGTTGCTCGGCGTACAGGC
CGTAGGGACAGATCTGCGGCGAATTGCGGCCGGCGGGCAGGGCGCCGGGCAGGGCTTC
GGTGGCGCAGGCGTTGCCGAAGCCGGTCTGATATTGCAAGGACATggatgcctcctggcggtgcggc
ctggttcggcgcggtggccgtccgggcttttttcggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgcc
atcaggagtgcagggagATG

    BPP0808 Gene: BPP0808     GI: 33595497     BI number: BPP0808     GOG: -------     Description: transposas   t a  g gc gc T  | A  | C  | At Gc Gc At A  g Cg                  gg Gc                 c  t Tg                 g  g Tg                  cg At                  gc Tg                  gc A  |                 cg Gc        gt       t  t Tg       g  t      t  | Cg       t  c       gc T  c       cg        gc Gc        cg        tg Gt        gc        cg Cg       |  g       cg Cg        gc        gc Gt        cg        gt                         tttttcggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgccatcaggagtgcagggagATG     ..................................................................................................................