                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGCAGGTGGTGGGTCAGGACGGCGAGGCGATTCCGGGCTTGTACGCATGCGGAAAC
GATATGTCGTCGGTGTTTCGCGGGTTTTATCCGGGGGCAGGCGCCACGCTGGGTCCGG
GCCTGGTATTCGCGTATCGCGCCATCGAGCACCTGGCGCGGTCCTCAGGCGGATCGGC
CGCGCAATCCGCTTGAcagcacgagatggtctcatttaaaactattcacatgcataaaataaaattcacacatgtgaataaatagcgg
gcccggcatcgggacctgcccaccaccaggagaccatcGTG

    BPP0878 Gene: BPP0878     GI: 33595561     BI number: BPP0878     GOG: COG3181     Description: putative exported protei   c                   G a  c                T  T g  a                A  C at                  TG gc                  AT g  G                 GC aT                  CG cG        AA       |  G cG       G  A      |  T a  C       GC       A  G c  A       CG        AT c  |      |  A       AT aT        GT        GT cG        TA        GC |  C       AT        CG cG        CG        GC cG        GT        TG                         GGTTTTATCCGGGGGCAGGCGCCACGCTGGGTCCGGGCCTGGTATTCGCGTATCGCGCCATCGAGCACCTGGCGCGGTCCTCAGGCGGATCGGCCGCGCAATCCGCTTGAcagcacgagatggtctcatttaaaactattcacatgcataaaataaaattcacacatgtgaataaatagcgggcccggcatcgggacctgcccaccaccaggagaccatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................