                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-15.60 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGTCAGCCGCGTCGCTATCGACGGCATACGGTTCCGGCCGTTGGCCAAGGCGGGAG
TCGAGTCGCAGCTGCTGGGCGTGTGGCGCGACGACGGGCACGACAGCCTGATCCAGCC
GCTGCTCGCCGCCATGGCGTCGTTGCTGCCGGCCGCGCGTCGATGAtgtcttgctcgccggccatg
ttcgcggccgcgacgggcaacggcatcatgccgcgcgggtccgatcattgccaaacggtaatgagcgggtaataccgcctgcgcgtcttttgactacgat
ctgcccatcggcgcggcaATG

    BPP0892 Gene: BPP0892     GI: 33595574     BI number: BPP0892     GOG: -------     Description: hypothetical protei   c g  a g  t       aa c  c      a  c a  a       cg at        cg cg        gt gc        ta gc        ta |  g       at gc        cg cg        ta a  |      a  | gc       g  | cg       c  | g  |      c  | cg       t  | cg       g  | gt       g  | gc       g  |       ta c  |       cg       a  c gc        gc       a  c cg        cg        tg ta       g  |       gc t  t       cg        gc gc        cg        gt ta        gt        cg at        ta        gc                         gcgtcttttgactacgatctgcccatcggcgcggcaATG     ..................................................................................................................