                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-23.20 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-22.30 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-24.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGAACTGATCGCCCACGAGCGCGGCGTGCCGCTGCCCGAAGTCGGCTATTACCGCC
TGCGTTTTCCCACCAAGCCGGTCACGCTGGGCGAGCTGGCCTCGCTGCCCCAGACCGA
GGCCTCGCGCCAGGCGGTGGTGCGCCTGAAGAAAACCGCCTGAcgcggccgcgcggcgcgcgtgcgcg
ggaaaacagggccgcaagccgcccccccgtggcgccgcgcgccacgggagcgtcatgttttcatcgtaaaatcccgtgctccccgcgctgctccggcgca
atgccctgcgtcagggATG

    BPP0898 Gene: BPP0898     GI: 33595580     BI number: BPP0898     GOG: COG2199     Description: putative membrane protei cg g  c       aa cg       c  g cg       g  c gc       c  c |  g       cg gc        gc cg        gc gc        gc cg       a  c At       c  | G  g      a  |        g T  c      a  |      c  c C  |      a  |       cg Cg       a  |       gc Gc        gc        cg Cg        gc        gc Cg        gc        gc A  g       cg        ta A  a       gt        gc A  a      |  g       cg A  a       cg        cg G  a       gc        cg A  |       tg       c  a A  |       gc       c  | Gc       c  |      c  | Ta        gc        cg Cg        cg        gc Cg        gc        cg                         tcatgttttcatcgtaaaatcccgtgctccccgcgctgctccggcgcaatgccctgcgtcagggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here     ..................................................................................................................