                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:174 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-15.07 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCTGGGCGCAGTGCTCAACTAGcgcttcacgccctcgcagctcgccgtctgcgactgacgtctcgcctggccgcaaagc
cgcgccgcctgcatataaataatttatggcggctgcgttttttttgatttgacgctgcgcggggcgtgaaacaccataggacacaagaacgagcaggccg
gcgcctggcgatcagccagtgccggaagacgtggtagttgactttcaggtagtacccggcagccggggcggcccttgcgcccccccggcacggacgcaca
ctggacaggacaaacatcATG

    BPP0906 Gene: BPP0906     GI: 33595588     BI number: BPP0906     GOG: COG0687     Description: putative extracellular solute-binding protei                      aa ga                 a  t t  c                t  a cg                 a  a at        ag       t  t gc       a  c      a  t c  t      a  c      c  t gc        cg       g  a tg        gc       t  t c  c       cg        cg t  c      |  c       cg gt       |  c       gc cg        cg        cg cg        gc        cg gc        gc        gc c  c      t  t      |  t t  |      c  |       cg cg        cg        gc gc        gc        cg                         ttttttttgatttgacgctgcgcggggcgtgaaacaccataggacacaagaacgagcaggccggcgcctggcgatcagccagtgccggaagacgtggtagttgactttcaggtagtacccggcagccggggcggcccttgcgcccccccggcacggacgcacactggacaggacaaacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0687 Spermidine/putrescine-binding periplasmic protein ... can be seen here     ..................................................................................................................