                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=10 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-30.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAGCCTGTCGGAACAGGACGTCAAGTCGTACGTCCTGGCCAATGCGCCGGCCTACC
AGCATCCGCGCCGCGTGTTCTTCGTCGAGTCGCTGCCGCTGGCGGCCACCAGCAAGGT
GGACCGGCGCGCCCTGGCGCTGCGCGCCCAGGCCGAGGCGTAGcgccagaaggccgtgccgatcggca
atgggctgctccatgagcagcccattccaattccgggcccggacacgcccgagaaggcacttattttccacgcgccggcgcgtagcatggatccatcgca
tcaataaggtggagacATG

    BPP0958 Gene: BPP0958     GI: 33595638     BI number: BPP0958     GOG: COG5553     Description: hypothetical protei   a c  t cg ta cg gc ta cg gc gc gc ta at at                  ga c  |                g  c gc                 c  a gc                 c  c c  a                 cg ta                  gc at                  gc gt                  gc c  c                 cg c  |                |  a gc                  cg tg                  ta g  |       gc        ta cg       g  c      a  | cg        gc       a  | gc        cg        cg gc        cg        cg                         cacttattttccacgcgccggcgcgtagcatggatccatcgcatcaataaggtggagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5553 Predicted metal-dependent enzyme of the double-stranded beta helix superfamily ... can be seen here     ..................................................................................................................