Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G=-11.76 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-13.06 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agagtaccggttttttaggggcggggtggccagtatgactggcgggctctccgtgcacgctacctgCTAGACTGACCGGCGCGGCG
GATTCGCCGCGGAGTCGAGCGACGCGAACTCGAAGGCAATTGGATATTCATCGGTTTG
TCTCGGGTTGGCCGCATCGGGACTCTCCGCCTTCAGGCGCTTCGGCGCATAATCATCG
GCATTTCTTCGGTAGGCGGCTGGACGCCTACTAATCACgttacgggcaaggtgccgacgtccgtgcccggaa
atccagaaaacactgccgacagactgATG

    BPP0992 --- BPP0991


Gene: BPP0992     GI: 33595669     BI number: BPP0992     GOG: -------     Description: hypothetical protein
Gene: BPP0991     GI: 33595668     BI number: BPP0991     GOG: -------     Description: hypothetical protei


  G
G  C
T  C
 TG
 GC
|  A
 GT
 GC
 CG
 TG
 CG
 TA
 GC
T  T
T  C
T  T
 GC
 GC
C  |
T  |
A  |                 TC
C  |                T  G
T  |                 CG
T  |                 GC
A  |                 CG
T  |                 GC
A  |                |  A
G  |                G  T
G  |                A  A
T  |                C  A
T  |                T  T
A  |       TC       T  C
A  |      T  A      C  A
 CG        CG       C  T
 GC        CG        GC
 GC        GC        CG
 AT        CG        CG
                        CATTTCTTCGGTAGGCGGCTGGACGCCTACTAATCACgttacgggcaaggtgccgacgtccgtgcccggaaatccagaaaacactgccgacagactgATG


    ..................................................................................................................