                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-24.51 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggcgagcccatcgacgagccggtggtgggccatgggccgttcgtcatgaacacccaggccgagatcgtgcaggccatcgacgacttcaaccgcggcgcg
ttcggccgcatgggctgagcggccatccccacgagggggggcctgtccccacggggacaggcccccctctctccgatatttcctgctttacgtggagcaa
atacctgacgctggcgcggacatctgcgagttactctggcttgccttcgtagcaacctctgccggcgttcatccgccggtttttttttattcggccagcc
ATG

    BPP1064 Gene: BPP1064     GI: 33595741     BI number: BPP1064     GOG: NOG10340     Description: putative exported protei            tt           c  g            gc            gc           t  |           c  |           t  |           c  |           a  |           t  |           t  |            gt            at            gc            cg            gt            ta ca        cg a  t      t  c gc       a  a gt       c  a cg       a  c gc        gc cg        gt g  a      c  c g  g       gt        ca t  t       cg       t  t c  t       gc       t  c g  a       gc        gc c  c       tg        cg at        cg        gc gc        gc        gc t  t       cg        cg cg        at        cg cg        gt        gt                         ttttttttattcggccagccATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -7.10 kcal/mol Antiterminator: Size=63 nt.     Delta G=-24.51 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cggcgagcccatcgacgagccggtggtgggccatgggccgttcgtcatgaacacccaggccgagatcgtgcaggccatcgacgacttcaaccgcggcgcg ttcggccgcatgggctgagcggccatccccacgagggggggcctgtccccacggggacaggcccccctctctccgatatttcctgctttacgtggagcaa atacctgacgctggcgcggacatctgcgagttactctggcttgccttcgtagcaacctctgccggcgttcatccgccggtttttttttattcggccagcc ATG     BPP1064 Gene: BPP1064     GI: 33595741     BI number: BPP1064     GOG: NOG10340     Description: putative exported protei cc a  t ac ct g  | a  | t  | g  | c  | t  | t  | cg cc gc tg tg cc gg g  t t  t c  c t  a c a t t g a        ca g       t  t c       t  c g        gc t        cg c        gc t        gc a        cg             gtttttttttattcggccagccATG     ..................................................................................................................