Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-25.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAAAGTGAAGAACACAGCAAGCATggtggcgcgccgggacggcgcgcacgcgcagtgtgcgcggagcgcatcggctcgtcg
cgcgagccggtgtttttcttacagcctgctgccgggcgcgtcagtcacgggcaagccggcggatcgccggcctcgtcgtccccggggtatcgctgcgcca
tgcggcgcaatgccgcgcaatgccgccaactggcggcggaaggcgcggcgggcaacatgacgagattgtcagaagattgtgcgcgagcgtgggaaaccgc
tgtttataatctcggaccATG

    BPP1077


Gene: BPP1077     GI: 33595753     BI number: BPP1077     GOG: NOG42262     Description: putative lipoprotei


  t
g  g
a  t
 cg
 gc
 cg
 gc
 cg
a  g
c  a
g  |        g
 cg       c  c
 gc       t  g
 cg        gc
 gc        cg
g  a       ta
c  |       cg
a  |       gc
g  |       gc
 gt        cg
 gc        tg
 cg        at
 cg        cg
 gc        gt
            ttttcttacagcctgctgccgggcgcgtcagtcacgggcaagccggcggatcgccggcctcgtcgtccccggggtatcgctgcgccatgcggcgcaatgccgcgcaatgccgccaactggcggcggaaggcgcggcgggcaacatgacgagattgtcagaagattgtgcgcgagcgtgggaaaccgctgtttataatctcggaccATG


    ..................................................................................................................