                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGCACGCGGTGCATCACGTGTTTTCCGCGCCCGAGCCGGCCGGGGCCGTACCGCCC
GCCCTGGTCGGAAAACTGGTTTTCATCGTGCGCGACATGGAACGCGAGGAGGTCCTGC
ACGCCGTGCGGCACCTGAGCGGCGCGCCGCCCGCCGATGCTGCGTAGgtgttaacaccagcccac
aatctgttaacacttttatggttttagggtagatttctgccttgagcgctggattttctgcgatttcagtgtcattcaagtaactatttgcttaatctgt
caacattaaaggaccagccATG

    BPP1130 --- BPP1131 --- BPP1132 Gene: BPP1130     GI: 33595805     BI number: BPP1130     GOG: COG3181     Description: putative exported protein Gene: BPP1131     GI: 33595806     BI number: BPP1131     GOG: COG1053     Description: putative fumarate reductase flavoprotein subunit Gene: BPP1132     GI: 33595807     BI number: BPP1132     GOG: COG2079     Description: putative exported protei   a c  c a  t a  t       tt t  t      a  t t  t       gc g  a       at t  t       tg cg        gc tg        gc at        gt at        at |  t       tg c  t       ta a  a       tg cg       |  c cg        tg cg        gc gt        gt             ggattttctgcgatttcagtgtcattcaagtaactatttgcttaatctgtcaacattaaaggaccagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here [C] COG1053 Succinate dehydrogenase/fumarate reductase, flavoprotein subunit ... can be seen here [R] COG2079 Uncharacterized protein involved in propionate catabolism ... can be seen here     ..................................................................................................................