Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions

GGTTAGAATACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAGCCCCGTCCGCTCCGC
CAaaagattccgaaaagccagttgctcacgcaactggcttttttctttccgggtgcctgtccccgcagggggactggcacccgcaaactctcggggtgc
ctgtccccgcagggacaggcaccgatccgcctccacgcctgccacttcccgcagggacaggcgcgaaccgccccccccctgctgtcgcccccgctttccg
caaaagagttgacacttttaccggctccttctacctttacgccATG

    BPP1135 --- BPP1134


Gene: BPP1135     GI: 33595810     BI number: BPP1135     GOG: COG1802     Description: probable GntR-family transcriptional regulator
Gene: BPP1134     GI: 33595809     BI number: BPP1134     GOG: COG2079     Description: conserved hypothetical protei


          ca
         t  c
          cg
          gc
          ta
          ta
          gc
          at
          cg
          cg
          gc
          at
          at
          at
          at
            ttctttccgggtgcctgtccccgcagggggactggcacccgcaaactctcggggtgcctgtccccgcagggacaggcaccgatccgcctccacgcctgccacttcccgcagggacaggcgcgaaccgccccccccctgctgtcgcccccgctttccgcaaaagagttgacacttttaccggctccttctacctttacgccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1802 Transcriptional regulators ... can be seen here
[R] COG2079 Uncharacterized protein involved in propionate catabolism ... can be seen here

    ..................................................................................................................