Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-28.50 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACGGTACGCTGCACCTGATGGACGAAGTGCTCACGCCCGACTCGTCGCGCTTCTGG
CCGGCCGACGGCTACCGGGTGGGCATCAGCCCGCCTTCGTTCGACAAGCAGTTCGTGC
GCGACTGGCTGGAAACCCAGCCCTGGGACAAGACCCCGCCCGCGCCGCGCCTGCCGCG
CGACGTGCTGGAAAAGACCGCCGCCAAGTACCGCGAAGCGCTCGACCGCCTGCTCGCC
TGAgccctgccggcgccgtccaggcccgccgcccttcggggcgcgcgggcttttttcattggaggcgtGTG

    BPP1195


Gene: BPP1195     GI: 33595868     BI number: BPP1195     GOG: NOG08272     Description: conserved hypothetical protei


 CC
G  T
 CG
 TA
 Cg
 Gc
|  c
T  c
C  t
 Cg
 Gc
C  |                 tc
C  |                t  g
A  |                 cg
 Gc         c        cg
 Cg       t  c       cg
T  |      g  a       gc
 Cg        cg        cg
 Gc        cg       |  c
 Cg        gc        cg
 Gc       |  c       gc
A  |      |  c       cg
A  |       cg        cg
 Gc        gc        cg
 Cg        gc        gc
 Gt        cg        gt
                        tttttcattggaggcgtGTG


    ..................................................................................................................