                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-28.50 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACGGTACGCTGCACCTGATGGACGAAGTGCTCACGCCCGACTCGTCGCGCTTCTGG
CCGGCCGACGGCTACCGGGTGGGCATCAGCCCGCCTTCGTTCGACAAGCAGTTCGTGC
GCGACTGGCTGGAAACCCAGCCCTGGGACAAGACCCCGCCCGCGCCGCGCCTGCCGCG
CGACGTGCTGGAAAAGACCGCCGCCAAGTACCGCGAAGCGCTCGACCGCCTGCTCGCC
TGAgccctgccggcgccgtccaggcccgccgcccttcggggcgcgcgggcttttttcattggaggcgtGTG

    BPP1195 Gene: BPP1195     GI: 33595868     BI number: BPP1195     GOG: NOG08272     Description: conserved hypothetical protei CC G  T CG TA Cg Gc |  c T  c C  t Cg Gc C  |                 tc C  |                t  g A  |                 cg Gc         c        cg Cg       t  c       cg T  |      g  a       gc Cg        cg        cg Gc        cg       |  c Cg        gc        cg Gc       |  c       gc A  |      |  c       cg A  |       cg        cg Gc        gc        cg Cg        gc        gc Gt        cg        gt                         tttttcattggaggcgtGTG     ..................................................................................................................