                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-11.21 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-24.01 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCACGCGCCCGAAAAGGCGATGGGTGATCCGGTCCAGCGGGTTACCGCCGTGGCGA
AGTGGTCGAACAGCCGGGACAGGGACCGGAGGCGGCCGGCCTCGCCATTGCCCGCCCG
GCGGCTGATCCGGCGACCGCTTTCGTCGCCGGCGGTTTTCTCGCACATgccacgtctccttcga
tgcgacggccgcaggccgcgcatttttcgtgcccgccgccccgcggacgcgcggcccgattggttaaactgccgtctttgcccgcgccgccaggcgcggg
ccggtttaccgattacggcaATG

    BPP1248 Gene: BPP1248     GI: 33595917     BI number: BPP1248     GOG: COG0500     Description: conserved hypothetical protei AC G  C CG GC GT C  T C  | T  | AT GC         t T  |      g  c CG       c  t GT       a  c GC       c  c CG       c  t GC       g  t GC       T  c C  |      A  g CG       C  a CG        At GC        Cg CG        Gc         c CG        Cg       g  a |  T       Ta        cg |  T      C  c       cg |  T      T  |       gc |  T      T  |       gc |  C       Tg        cg |  T       Tg       a  | |  C       Gc        gc CG        Gc        cg GC        Cg        gc TA        Gc        ta                         tttttcgtgcccgccgccccgcggacgcgcggcccgattggttaaactgccgtctttgcccgcgccgccaggcgcgggccggtttaccgattacggcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QR] COG0500 SAM-dependent methyltransferases ... can be seen here     ..................................................................................................................