Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGGCGTGGTCGAGCGCCGCCAGTTGCAGGCGTTCCTTGTCGCCGAACAGTACTTGC
AGATTGCTTTTCCCTACTTCGGCCCGCTCGGCGACCTGGCCGAAGGTGATGCCGTCCA
GTCCCTCGACGGAGAGGAGTTTGACGGCTTCGTCCAGGACGCGTGCGCGCGCGCGTTC
GCCGCGCAGCCGGCGGCCGTCGACGGTGGGGGCGGGGGCAGGTTGAGTCATGGCAGGG
TTCGGCGTATTTGCGCGGACGGGGTTTTTCATCATACTATAAATACGATCGTACATat
atttataaggATG

    BPP1269


Gene: BPP1269     GI: 33595936     BI number: BPP1269     GOG: COG0477     Description: probable membrane efflux protei


            T
          G  T
          G  G
          A  A
           CG
           GT
  G        GC
G  T      G  A
C  G      G  T
A  G      G  G
G  G       CG
 CG        GC
 TG       |  A
 GC       |  G       AT
 CG       |  G      T  T
 CG       G  G       GT
G  G       GT        CG
G  G       GT        GC
 CG        GC       |  G
 GC        TG        GC
G  A      G  G       CG
 CG        GC        TG
 CG        CG        TA
 GT        AT        GC
                        GGGGTTTTTCATCATACTATAAATACGATCGTACATatatttataaggATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here

    ..................................................................................................................