                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-15.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCCCGAAGCGGCGCGCGCCATCGAAGGCATCGCGCACGATGAGCAGCGACCAGCGAT
CGCCGATCAGGTCGACACAGCGCGCAACGGGACAAGGTTCGTCGTTCATAGGCTTGCG
GGGCGGCATggatgctccttgccaggcggtcctggcgatctccggttttattttaaaactacatggcctagcattcaactggttttaatttgaa
accacaatgcgcgaacccgcaaccatgaaaacctctctcgcatctgcgttaccgccctgttcaggcagcgcgccagcctggtccgcgggcATG

    BPP1270 Gene: BPP1270     GI: 33595937     BI number: BPP1270     GOG: COG0477     Description: putative membrane protei TT G  C G  G A  T A  C CG AT GT GC                  gg G  A                c  t C  T       gg        gc A  A      T  a       gc A  G       At        at CG        Cg        cg GC        Gc        cg C  T       Gt        gc GT       C  |       tg CG        Gc        ta GC        Gc       c  t A  G       Gt       c  c C  G       Gt       t  | A  G       Cg       c  | C  G      |  c      g  | A  |       Gc       t  | GC        Ta        at CG        Tg        gc TG        Cg        gc GC        Gc        Tg                         gttttattttaaaactacatggcctagcattcaactggttttaatttgaaaccacaatgcgcgaacccgcaaccatgaaaacctctctcgcatctgcgttaccgccctgttcaggcagcgcgccagcctggtccgcgggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................