                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-34.00 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-13.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCAATGCCGAGGTCGACAAGCTGCTGGCCGAGGCGCGCACCGTGCCCGACCAGGCCA
AGCGCAAGGCGATCTACGACCAGGCCCAGGCGCTGCTGCAGGCCGACACGCACGATAT
TTACCTGTACTACCAGCCGTGGCCGTTCGTGCTGGGCAAGAACGTACGCGGCTTCAAG
CCGTACCCGGACGGCATGGTGCGCCTGAAGGGCGTGACGCTGGCCAAGTAGcgacggtgggg
gcggccggctgccgcgatcggcgcggcgcgcgggcgccgccgcgcccgtttttcggtggcgaccATG

    BPP1444 --- BPP1445 Gene: BPP1444     GI: 33596101     BI number: BPP1444     GOG: COG0601     Description: ABC-transport protein, inner membrane component Gene: BPP1445     GI: 33596102     BI number: BPP1445     GOG: COG1173     Description: probable ABC-transport protein, inner membrane componen             c           t  g           a  g            gc            cg            gc            cg            cg   c        gc g  c      t  | g  g       cg cg        gc gc       |  g gt        gc g  g       cg gc        cg        gc gc       g  g      c  c tg        gc        cg gc        cg        gc g  g       gc        cg c  a       gc        gc at       g  g       gc gc        gc        gc cg        gc        cg                         tttttcggtggcgaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here     ..................................................................................................................