                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-27.60 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-27.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTCGGACTTGAGCGCCACCGGCCTGTGCATCCAGGTCCAGGCGCCGCCGGCCGCCA
GCGCGGCGCCGAGCAGCGCCACCAGCACGAGCAGCAGAAAATAGAAACGAATGCGTTT
TCTCATAAGTGTGCGCAAgtttaatggatcgcgggcgcggcggctggcccgcccacgcccccgcggtcagccgggtcataggggccg
gcgcgggccgccccgggtatcatcggggtttgttcgacgccgcgcggcccacgccggttcgcgcgtgcgcgtcatccgccccttttagaattccgccAT
G

    BPP1557 Gene: BPP1557     GI: 33596201     BI number: BPP1557     GOG: COG0354     Description: conserved hypothetical protei            ta           a  g            cg            tg gc       g  g g  c       gc t  c       gc cg        cg gc        cg gc        gc c  c      |  g g  a      |  c gc       a  g cg        cg gc        tg c  c       gc gc        gc        at gc        cg       t  c gc        gc       g  a cg       |  c       gt gc       c  c       gc cg       c  c       cg tg        cg        cg at        cg        cg gc        cg        cg                         tttgttcgacgccgcgcggcccacgccggttcgcgcgtgcgcgtcatccgccccttttagaattccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0354 Predicted aminomethyltransferase related to GcvT ... can be seen here     ..................................................................................................................