                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGCACTGCGCCGACAGCCAGGCCAGGGTGCGTTTCTGCCGCTTGCGCAAGGCCCGG
ATGCGCAGGCCGATCTGTTCGGGGCTGGGCGCGGGAATGGGCGGCGATTTGGCGGTCA
TGGGCGGTGGCGGGGAATGCGTCAGCACGCATGATGCCATttttgggcgcggcccgccgtcttgcgggtt
ttccctcgttgagtgtttgggcaattatttgtatgttgggcaacaagttgcctataaggcaataacaaggcaataaattgctctcgcttggcgaggcgga
accgaatggaaagcATG

    BPP1650 --- BPP1651 Gene: BPP1650     GI: 33596284     BI number: BPP1650     GOG: COG0235     Description: putative aldolase Gene: BPP1651     GI: 33596285     BI number: BPP1651     GOG: COG4663     Description: putative exported protei   G G  G T  C CG GC G  G        G G  G      G  C G  |      G  G CG        TG TA        AT TA        CG GT        TG TG       G  |       AG CG        GC       C  C TG        CG        TA A  |      G  G       GC GC       G  G       CG CG        TG        GC CG        TA        TA GC        TA        AT |  G       AT       A  G |  A      |  G      G  A |  T       GC       G  | |  T       CG       G  | G  T       GT        GT A  G       GC        CG CG       |  A       GC GC        CG        GC CG        GC        TA                         TttttgggcgcggcccgccgtcttgcgggttttccctcgttgagtgtttgggcaattatttgtatgttgggcaacaagttgcctataaggcaataacaaggcaataaattgctctcgcttggcgaggcggaaccgaatggaaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0235 Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases ... can be seen here [Q] COG4663 TRAP-type mannitol/chloroaromatic compound transport system, periplasmic component ... can be seen here     ..................................................................................................................