Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -7.89 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-21.00 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGGCCGCGTGTCGCTGCTGACGCGCGAGGCCTTGGCGACCGATCCGTACGCCGCGA
TCGCGGCCACCGGCGCGTTCATCCTGATCGACGAGGCCACGCACCAGACGGCTGCCGC
GGGCATGCTCGAATAGgcggccgccagactccccgccaggctgttgtttttaatccaaacccttgctgggcgcggttctccgggcgat
ttccaaaggatgaaatgatttccccggacggcgtcgccgtcttggggtaaattcgatgcatggctcgcaagggctgcggggcttgtcaaaagtgctGTG


    BPP1662


Gene: BPP1662     GI: 33596296     BI number: BPP1662     GOG: COG1533     Description: conserved hypothetical protei


 CG
T  A
A  C
G  G
 TA
 CG
 CG
T  C
A  C
C  |
T  |
 TA
 GC
 CG
 GC
|  A
|  C
|  C       AT
|  A      C  G
|  G       GC
|  A       GT        tc
|  C       GC       c  c
|  G       CG       a  c
|  G      |  A      g  c
|  C      |  A      a  g
|  T      |  T      c  c
 CG       G  A      c  c
 GC        CG       g  a
 GC        Cg        cg
 CG        Gc        cg
C  C       Tg        gc
A  G       Cg        gt
 CG        Gc        cg
 CG        Gc        gt
 GC        Cg        Gt
                        gtttttaatccaaacccttgctgggcgcggttctccgggcgatttccaaaggatgaaatgatttccccggacggcgtcgccgtcttggggtaaattcgatgcatggctcgcaagggctgcggggcttgtcaaaagtgctGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG1533 DNA repair photolyase ... can be seen here

    ..................................................................................................................