                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACCTGCGCAGCCGCTCGGGCAAGTCCGCACGCATCAAGGAAAAGCTGGTTCTCAAGA
AAGCCAAGTCGGCTTGAtcgagaccggggccgtgtccggcatgcaaacgtcgacgcgtttgtgcctggcacggctttccgcgataaaa
gggcacccgcaagggtgcccttttatcgtgaaaaagtatctgaaagaatgccttttcagagtgaaagggcacccgcaagggtgcccttttatcgtgaaaa
gatatctggagaagcgtctttttcgcctgaaagggcacccttgcgggtgcctttTTG

    BPP1666 --- BPP1667 Gene: BPP1666     GI: 33596299     BI number: BPP1666     GOG: COG0494     Description: conserved hypothetical protein Gene: BPP1667     GI: 33596300     BI number: BPP1667     GOG: COG0667     Description: probable oxidoreductas   a g  g g  a ta cg t  c a  | tg at gc |  t at at at at gc tg                  tg gc                 t  c c  c                 cg t  |       aa        cg at       g  a       cg tg        tg        at ta        cg        cg ta        cg        gc ta        gc        gc                         tttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here [C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-20.50 kcal/mol Antiterminator: Size=44 nt.     Delta G=-12.52 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-31.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TACCTGCGCAGCCGCTCGGGCAAGTCCGCACGCATCAAGGAAAAGCTGGTTCTCAAGA AAGCCAAGTCGGCTTGAtcgagaccggggccgtgtccggcatgcaaacgtcgacgcgtttgtgcctggcacggctttccgcgataaaa gggcacccgcaagggtgcccttttatcgtgaaaaagtatctgaaagaatgccttttcagagtgaaagggcacccgcaagggtgcccttttatcgtgaaaa gatatctggagaagcgtctttttcgcctgaaagggcacccttgcgggtgcctttTTG     BPP1666 --- BPP1667 Gene: BPP1666     GI: 33596299     BI number: BPP1666     GOG: COG0494     Description: conserved hypothetical protein Gene: BPP1667     GI: 33596300     BI number: BPP1667     GOG: COG0667     Description: probable oxidoreductas ga c  c tg gc         t cg       t  c at       t  c at        cg at        gc cg       |  g gt       g  a t  |      c  t a  |      a  a cg       c  a gc       g  a gc       g  a c  t       tg cg        cg tg        cg        ca gc        gc       g  a ta        ta        cg gc        gc        cg cg       t  c       cg cg       t  |       at gc       t  |       cg gt        gc        gc gt        cg        gc gt        gc        gc                         ttttatcgtgaaaagatatctggagaagcgtctttttcgcctgaaagggcacccttgcgggtgcctttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here [C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-20.50 kcal/mol Antiterminator: Size=44 nt.     Delta G=-12.52 kcal/mol Anti-antiterminator:   Size=46 nt.     Delta G=-28.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TACCTGCGCAGCCGCTCGGGCAAGTCCGCACGCATCAAGGAAAAGCTGGTTCTCAAGA AAGCCAAGTCGGCTTGAtcgagaccggggccgtgtccggcatgcaaacgtcgacgcgtttgtgcctggcacggctttccgcgataaaa gggcacccgcaagggtgcccttttatcgtgaaaaagtatctgaaagaatgccttttcagagtgaaagggcacccgcaagggtgcccttttatcgtgaaaa gatatctggagaagcgtctttttcgcctgaaagggcacccttgcgggtgcctttTTG     BPP1666 --- BPP1667 Gene: BPP1666     GI: 33596299     BI number: BPP1666     GOG: COG0494     Description: conserved hypothetical protein Gene: BPP1667     GI: 33596300     BI number: BPP1667     GOG: COG0667     Description: probable oxidoreductas ga         g c  c      g  c tg       c  t gc        at cg        ct at       |  c at       g  c at       g  g cg       t  c gt       c  g t  |      c  a a  |      g  t cg        ta gc        ga gc        ta        ca c  t       ta       g  a cg        tg        cg tg        gg        cg gc       c  g       cg ta       g  |       at gc       c  |       cg cg        ac        gc cg        ga        gc gc        cc        gc                         ttttatcgtgaaaaagtatctgaaagaatgccttttcagagtgaaagggcacccgcaagggtgcccttttatcgtgaaaagatatctggagaagcgtctttttcgcctgaaagggcacccttgcgggtgcctttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here [C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here     ..................................................................................................................