                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCTGGAACAGTGTTTCGTAGGCCTTGTCCCAACGCTCGAACAGCGCCTCGATCAT
GGCGTCCTTGCTGCCGTAGCAGTACTGGATGCCGCCCTTGGTGACCCCCATTTCCCTG
GCGACCGCGTCGATGGTCAGGCCCTTGGCGCCGTCGCGCACGACGATGGTTTCGGCCG
CGTCGAGCACcttgtcgcggtcaatgctgcgttttcgtcccatgcgggccccttttcaatacatacgtatggatttatattataggcacgccc
gttccggcgtgacttttttcaaggcattccatcATG

    BPP1719 Gene: BPP1719     GI: 33596351     BI number: BPP1719     GOG: COG0477     Description: putative inner membrane efflux protei ta a  c cg at ta at a  g cg ta |  t |  t |  t |  a |  t |  a |  t |  t       tt t  a      g  c t  t      c  c ta        cg cg        cg cg        gc |  c       cg |  a       at c  c       cg cg       |  a gc        gc gc        gt             tttttcaaggcattccatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................