                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:27 nt.    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.80 kcal/mol
Antiterminator:    Distance from promoter:26 nt. Size=16 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:    Distance from promoter:11 nt.    Size=21 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaaa-tatatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaaatatcattggtgcaggtttcatatattggacaaatggcggccggaagtctactgtggccaggcgggcatgtgctccgcttgccgttttgtcgag
aaccccATG

    BPP1792 Gene: BPP1792     GI: 33596419     BI number: BPP1792     GOG: COG0477     Description: putative transport protei                      tg                     a  t                      cg                      gc                     |  t ct                  gc t  a                 gc gc                  cg at        gg        gc a  g      a  c       gt g  |       cg        at gt        cg       c  | cg       g  g       cg cg        gc        gc gc        ta        gc gc        gt        tg                         ttttgtcgagaaccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................