                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCATCCACACCCGCGAAACCGTCGAAATGGACGGCAAGACGTACCCGCTCTTCAAGTG
CGACGTGACGTCCGAATCGCACCCGTTCTACACCGGCGCGCAGACGCGTATCGTCGAG
ACCGGCCGCGTGGAAAAATTCCGCGCCCGCTTCGCCCGCACCGCCGGGACGGTCAAGT
CGGCGTCCTGAtcggcaagctccttcgggaggcgcaccagaaagcagcctgcgggctgcttttttttcctcgcggcatgccgcgccaaccct
catcggttccacgctcgtcggttacattacgtccGTG

    BPP1846 Gene: BPP1846     GI: 33596469     BI number: BPP1846     GOG: COG1807     Description: putative membrane protei            gc ag       t  g c  a       cg c  a       cg a  a       gc cg        at gc        cg |  a       gc cg        at gc        at gc        at             tttttcctcgcggcatgccgcgccaaccctcatcggttccacgctcgtcggttacattacgtccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1807 4-amino-4-deoxy-L-arabinose transferase and related glycosyltransferases of PMT family ... can be seen here     ..................................................................................................................