                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACGTGACCACGGTGGAGCGCATCATCGGCTTCAAGCGCGGCACCGGCGGCACCTCCG
GCGTCACCTACCTGCGCAAGATGCTGGAGGTGGTGCTGTTTCCGGAAATCTGGAAATT
GAGGACGGATCTCTGAcgccacacgggccttgtatcggggccaggtatgcgtgctagaatgcagggttgttttttggatacgttgcca
gacggcgcatcctggttgccgccacgcaagacgcgtggccgtgcgccgggcggcttgcacggcctggctggcgacccgctaacctgggaaattatcATG

    BPP1847 Gene: BPP1847     GI: 33596470     BI number: BPP1847     GOG: COG0254     Description: 50S ribosomal protein L3   a t  t gc tg        ta tg       c  g cg       g  a cg        ta gc        gt gc        cg g  a       gc c  g       ta a  |      a  g cg       t  | at       g  | |  a      g  | c  t      a  | cg        cg gc        cg cg        gt At        gt             gttttttggatacgttgccagacggcgcatcctggttgccgccacgcaagacgcgtggccgtgcgccgggcggcttgcacggcctggctggcgacccgctaacctgggaaattatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0254 Ribosomal protein L31 ... can be seen here     ..................................................................................................................