                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-31.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcacgttgtgcacgctttggcgcgtgattgctgtgattgacgccatttggcgcgtgagtcgcaaatgcgccgggtttgcctttttgcagggcaggccagc
cgggtgggcggcgcgccaggggaacctggaatgagcacgcggccaccagcgggccgcgggcaagcgcggccgatttttgcaatatattttgggtcgcaat
tttgggcttgggttcggcaagcggcgctgtcagcagcgcccggccgggggccaggcaatacggtgggctgggcgtgcagcccatttttttttttgagtgt
ATG

    BPP1860 --- nusA Gene: BPP1860     GI: 33596481     BI number: BPP1860     GOG: COG0779     Description: conserved hypothetical protein Gene: nusA     GI: 33596482     BI number: BPP1861     GOG: COG0195     Description: N utilization substance protein ca t  g gc ta cg gc cg gc         a gc       c  a c  c      g  t g  g      g  a a  |      a  c a  |       cg cg        cg gc        gt gc       g  g       cg |  g      g  |      g  t cg       g  |      g  g tg       g  |       gc tg        cg        ta g  g       cg        cg gc        gc        gc gc        gt        gc ta        cg        gc tg        cg        ta cg        cg        gt gc        gc        gt                         tttttttttgagtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-10.20 kcal/mol Antiterminator: Size=36 nt.     Delta G=-17.10 kcal/mol Anti-antiterminator:   Size=18 nt.     Delta G=-13.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gcacgttgtgcacgctttggcgcgtgattgctgtgattgacgccatttggcgcgtgagtcgcaaatgcgccgggtttgcctttttgcagggcaggccagc cgggtgggcggcgcgccaggggaacctggaatgagcacgcggccaccagcgggccgcgggcaagcgcggccgatttttgcaatatattttgggtcgcaat tttgggcttgggttcggcaagcggcgctgtcagcagcgcccggccgggggccaggcaatacggtgggctgggcgtgcagcccatttttttttttgagtgt ATG     BPP1860 --- nusA Gene: BPP1860     GI: 33596481     BI number: BPP1860     GOG: COG0779     Description: conserved hypothetical protein Gene: nusA     GI: 33596482     BI number: BPP1861     GOG: COG0195     Description: N utilization substance protein             c           g  c           g  g           c  g           c  g            cg            gg            cc           g  c           a  |           c  | ca       g  |       cg t  g       aa       g  t gc        cg       g  g ta        tg        gc cg        gc        ta gc        ta        cg cg        ca        gc gc        gt        gc gc        ca        gc                         atttttttttttgagtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:111 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G=-14.20 kcal/mol Antiterminator: Size=27 nt.     Delta G=-16.70 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G=-24.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gcacgttgtgcacgctttggcgcgtgattgctgtgattgacgccatttggcgcgtgagtcgcaaatgcgccgggtttgcctttttgcagggcaggccagc cgggtgggcggcgcgccaggggaacctggaatgagcacgcggccaccagcgggccgcgggcaagcgcggccgatttttgcaatatattttgggtcgcaat tttgggcttgggttcggcaagcggcgctgtcagcagcgcccggccgggggccaggcaatacggtgggctgggcgtgcagcccatttttttttttgagtgt ATG     BPP1860 --- nusA Gene: BPP1860     GI: 33596481     BI number: BPP1860     GOG: COG0779     Description: conserved hypothetical protein Gene: nusA     GI: 33596482     BI number: BPP1861     GOG: COG0195     Description: N utilization substance protein ga g  a gc gc at cg cg |  a |  a g  t c  g g  a        a cg       c  g gc       c  c |  a      a  g gc        cg        ca cg        cg       g  a gc        gc       g  g |  g       gc        gc |  g       cg        cg gc        gc        gc gc        cg        cg ta       a  g       cg gc        cg        gc gc        gc        gc                         gatttttgcaatatattttgggtcgcaattttgggcttgggttcggcaagcggcgctgtcagcagcgcccggccgggggccaggcaatacggtgggctgggcgtgcagcccatttttttttttgagtgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here     ..................................................................................................................