Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-15.10 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-20.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCAACCCGCCGGCCGCCACCAGCCGGGGCTTTCGCATCGCCAACTACGAGCGCATCG
AACCGGTGCTCAACACCCAGCTGACCGCGGCCTTCGACGGCAAGACCCCGCCGGTCGC
GGCGCTGAACAATGCCGCTTCGCAGGCGCGCTCGCTCGCCGCGCAACGCTGAgcgttcagg
cgacgctacagacccgggccgctggcccgggttttttttgggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggta
tttgccatcaggagtgcagggagATG

    BPP1903


Gene: BPP1903     GI: 33596522     BI number: BPP1903     GOG: -------     Description: transposas


 GC
C  T
T  C
 CG
 GC
|  C
 CG
 GC
 CG         g
 GC       a  g
|  A      c  c
G  A       tg
A  C       ta
 CG        gc
 GC        cg
C  T       gc
 TG        At
 TA       |  a
 Cg        Gc
 Gc        Ta         c
C  |       Cg       g  t
C  |      G  a       cg
G  |      C  c       cg
T  |      A  c       gc
A  |      A  |       gc
A  |      C  |       gc
 Cg        Gc        cg
 At        Cg        cg
 At       G  |       cg
 Gc        Cg        at
 Ta        Cg        gt
 Cg        Gc        at
                        tttttgggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgccatcaggagtgcagggagATG
    ..................................................................................................................