Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGACGGAGGCATCAGGCTGTTGGCCAGGAAGTCTTCCAGCGCAACCCGGAATTCCTG
GAATACGGGAAACGCCGTGAACAGCGACAGCACGACGGCCAGCATCGGCACGATGGCC
AGCACGGTGGTGAACGTCAGGCTCGAGGCCACCTGCAACAGCTTCTGCTCGTCGGCGC
GCTGGCCCGCGAAGCGCACGACCCGGCCCATGCGCGTGAACCATGAGGCGCGCCGTTT
TTCGGGCGGGGCCGCCTGTCCGGCGGCGGCGGATTCGGCGTGAGGCTCCATcaggcgataat
agcagcATG

    BPP1918 --- BPP1919


Gene: BPP1918     GI: 33596536     BI number: BPP1918     GOG: COG3308     Description: putative membrane protein
Gene: BPP1919     GI: 33596537     BI number: BPP1919     GOG: COG0397     Description: conserved hypothetical protei



  C
G  G
A  C
A  A
 GC
 CG        CC
|  A      A  A
|  C      A  T
G  C      G  G
C  C      T  A
 CG       G  G
 CG        CG
 GC        GC
 GC        CG
|  C       GC
|  A      T  |
T  T      A  |
 CG       C  |
 GC       C  |
 CG        CG
 GC        GC
 CG        GC
 GT        CG
            TTTTTCGGGCGGGGCCGCCTGTCCGGCGGCGGCGGATTCGGCGTGAGGCTCCATcaggcgataatagcagcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3308 Predicted membrane protein ... can be seen here
[S] COG0397 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................