                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=30 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGGTGCTCGACTATCTGGAAGACGCCTGTCAGGGTGTGCTGGAACTGGTGCGCAAG
CGCGCCACGCAATACCAGGCGGCCTGAtccgtcgccgtccgcggcgctggggcaagtggggggatctgcaatgggtccgt
accccaaaatgagaaaaccgcgcgactgcgcggttttttctgaccgagatacttagcgttttactcgggaatttgctatacttgacccaattactcgggt
attgatgcccagtccagcgcccgatgcgtcgggttttcttccggattcacaggaaacacaccATG

    BPP2027 --- iscS --- iscU --- iscA --- hscB Gene: BPP2027     GI: 33596642     BI number: BPP2027     GOG: COG1959     Description: putative DNA-binding protein Gene: iscS     GI: 33596643     BI number: BPP2028     GOG: COG1104     Description: cysteine desulfurase Gene: iscU     GI: 33596644     BI number: BPP2029     GOG: COG0822     Description: [Fe-S] cluster formation/repair protein Gene: iscA     GI: 33596645     BI number: BPP2030     GOG: COG0316     Description: [Fe-S] cluster formation/repair protein Gene: hscB     GI: 33596646     BI number: BPP2031     GOG: COG1076     Description: chaperone protei ct a  t t  g a  a t  c c  c gc ta ta t  t a  t a  a        c gc       c  c gt       g  a gc        tg cg        at tg       |  c cg        gc at        ta ta        tg        gc |  t      a  c      t  g t  t      t  g       at tg        gc        gc ta        gc        cg gt        gc        cg cg        cg        cg gc        ta        gt                         tttcttccggattcacaggaaacacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1959 Predicted transcriptional regulator ... can be seen here [E] COG1104 Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes ... can be seen here [C] COG0822 NifU homolog involved in Fe-S cluster formation ... can be seen here [S] COG0316 Uncharacterized conserved protein ... can be seen here [O] COG1076 DnaJ-domain-containing proteins 1 ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.00 kcal/mol Antiterminator: Size=70 nt.     Delta G=-26.94 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G=-18.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAAGGTGCTCGACTATCTGGAAGACGCCTGTCAGGGTGTGCTGGAACTGGTGCGCAAG CGCGCCACGCAATACCAGGCGGCCTGAtccgtcgccgtccgcggcgctggggcaagtggggggatctgcaatgggtccgt accccaaaatgagaaaaccgcgcgactgcgcggttttttctgaccgagatacttagcgttttactcgggaatttgctatacttgacccaattactcgggt attgatgcccagtccagcgcccgatgcgtcgggttttcttccggattcacaggaaacacaccATG     BPP2027 --- iscS --- iscU --- iscA --- hscB Gene: BPP2027     GI: 33596642     BI number: BPP2027     GOG: COG1959     Description: putative DNA-binding protein Gene: iscS     GI: 33596643     BI number: BPP2028     GOG: COG1104     Description: cysteine desulfurase Gene: iscU     GI: 33596644     BI number: BPP2029     GOG: COG0822     Description: [Fe-S] cluster formation/repair protein Gene: iscA     GI: 33596645     BI number: BPP2030     GOG: COG0316     Description: [Fe-S] cluster formation/repair protein Gene: hscB     GI: 33596646     BI number: BPP2031     GOG: COG1076     Description: chaperone protei             a           c  a           g  t            tg            cg            tg            at            gc            gc           |  g           |  t           |  a            gc cc        gc t  g       gc gc        gc cg        ta cg       |  a gc       g  a cg       a  a t  c       at gt        cg cg       g  a cg       g  g t  |      g  a A  |      g  a G  |      t  a T  |      c  a Cg       g  | Cg       c  |       ac Gc        gc       g  t |  a       gc        cg G  a       cg        gc Cg        gc        cg Gt        cg        gc G  g      |  c       cg A  g       cg        cg Cg        ta        at Cg        gc        at                         ttttctgaccgagatacttagcgttttactcgggaatttgctatacttgacccaattactcgggtattgatgcccagtccagcgcccgatgcgtcgggttttcttccggattcacaggaaacacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1959 Predicted transcriptional regulator ... can be seen here [E] COG1104 Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes ... can be seen here [C] COG0822 NifU homolog involved in Fe-S cluster formation ... can be seen here [S] COG0316 Uncharacterized conserved protein ... can be seen here [O] COG1076 DnaJ-domain-containing proteins 1 ... can be seen here     ..................................................................................................................