                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-22.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGCATGCGATGGTGCATGGCGGGCCATTCCCGTCGACCTCGAATGCCCGGGCGACG
TCGGTGGGCGCCAGCGCCATCGACCGGTTCCTGCGTCCGGTCTGCTATCAGGATTTCC
CGAGCGAGCTGGTGCCGGCGGCATTGCAGGACGGCAATCCGCTTGCATTGTGGCGCTT
GCGCGATGGGCGCATGCAGCAGGGCTGAgcgatggcgcggccgatccctggccgcgccgcggacaagaccctgcgccga
ttgaacgcagcctgagcgctgcatttttgactggtatggaggatgacATG

    BPP2086 Gene: BPP2086     GI: 33596701     BI number: BPP2086     GOG: -------     Description: Hypothetical protei            ag           a  a           c  c           a  c            gc            gt            cg            gc            cg           |  c           |  c   c       |  g t  c      |  a a  c      |  t gt       |  t cg       |  g cg       |  a gc       c  a       ga gc        gc       t  g cg        cg       c  c gc        gc        cg cg       c  a       gc gc        cg        at gc        gc        cg tg        gc        gc                         atttttgactggtatggaggatgacATG     ..................................................................................................................