Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCCTGAGGCAAACCAGTCAACCCACCGAAGCGCAACGGCGCGCCCTGCGCACCCTCG
AGACAGCGCGCCAGCTGATGGCCGAGAGCGGCGCGACCCCGCCCGCGGCCGACCCGGT
ATCGACCGAGGCCGAGCTGGTCGCGTACCTGAACCAACGCTACGCCAGGCCGGCCAAC
CGTTAGggcgcgcgatacaggctgcgcgcggtatgtaacgcgacgatagttttgtattcacggcgttacgagtggaaagtggccgccgggtacact
gctggcgatcgaatttcttcgccttcagccATG

    BPP2157


Gene: BPP2157     GI: 33596770     BI number: BPP2157     GOG: COG0766     Description: Putative UDP-N-acetylglucosamine 1-carboxyvinyltransferas


 tg
a  t
t  a        g
g  a      t  g
 gc       g  a
 cg       a  a
 gc       g  a
 cg        cg
|  a       at
 gc        tg
 cg        tg        ca
|  a      |  c      a  c
 gt        gc       t  t
 ta        cg       g  g
 cg        gc        gc
|  t       gc        gt
 gt        cg        cg
 gt       a  g       cg
 at       c  |       gc
 cg       t  |       cg
 at        tg       c  a
 ta        at       g  t
 at        ta        gc
 gt        gc        tg
                        aatttcttcgccttcagccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0766 UDP-N-acetylglucosamine enolpyruvyl transferase ... can be seen here

    ..................................................................................................................